                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:207 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTGCGTGGGCTAAATTCCAGCAAAATCGCTGTTGGATACAAATCCAGCAATTGATAA
AAAGCCCGGGTTGGCGTAAGCATatcgggatttcttgatgaaggaccactcgcggcgcttgggcggccaatcttgcgaattga
tcaaatgttagggtttctggcataacacaccgttgtatttatgtaatgctgcaatagtacgacagttcgctacggttgtcaacagatgggttcatagcgg
tagcctcaattgatttggatatggtatactggccggtcgcttacttactgatttgtaaaATG

    CBU1151 Gene: CBU1151     GI: 29654457     BI number: CBU1151     GOG: COG0546     Description: hydrolase, haloacid dehalogenase-like famil            TA           G  A            CG            GC           G  A GG       T  T G  T      T  a C  T      G  | CG        Gt CG        Gc GC        Cg TG        Cg AT        Cg             atttcttgatgaaggaccactcgcggcgcttgggcggccaatcttgcgaattgatcaaatgttagggtttctggcataacacaccgttgtatttatgtaatgctgcaatagtacgacagttcgctacggttgtcaacagatgggttcatagcggtagcctcaattgatttggatatggtatactggccggtcgcttacttactgatttgtaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0546 Predicted phosphatases ... can be seen here     ..................................................................................................................