Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAGGGGCTGAagcttgggcgggcgacgttcctttctatattacaagtaaccctttcatcgccaattgttacgctaaattagtcatccgatt
tattcaggattggattaacctgcaccctgaatcgagatacgaacctttttatgttttagagctgggggcgggaagtgggcaattcagcttttttgtatta
aaacaactaaactcccttcaaactcaattaaatttatcgcatcttaatatcaagtatgtaatgagtgatttcactgaaaataatgtgagtttttggcaaa
atcagaagATG

    CBU1160


Gene: CBU1160     GI: 29654465     BI number: CBU1160     GOG: NOG41004     Description: TPR domain protei


  t
t  a
a  a
 gc
 gc
|  t
|  g       tt
t  c      t  t
t  a      t  a
a  c      c  t
 gc        cg
 gc        at
 at        at
 cg        gt         a
 ta       |  t      a  g
t  |      c  a      g  t
a  |      a  g      g  g
t  |      t  a      g  g
t  |      a  g       cg
 ta        gc        gc
 at        at       |  a
 gc       g  g      g  a
 cg        cg       g  t
|  a       tg        gt
 cg       a  g       gc
 ta       a  g       ta
 at        gc        cg
c  |       tg        gc
 ta        cg        at
 gc        cg        gt
                        ttttgtattaaaacaactaaactcccttcaaactcaattaaatttatcgcatcttaatatcaagtatgtaatgagtgatttcactgaaaataatgtgagtttttggcaaaatcagaagATG


    ..................................................................................................................