                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:84 nt.    Distance to gene:76 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -8.40 kcal/mol
Antiterminator:    Distance from promoter:50 nt. Size=44 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgatt-tataat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgatttagcgagtgagggaattataattcgcagtcgcacaatgcgcggggttgccgaagaggcaccgggcgcttataaagatgttgatgaagttgcaga
atcaactgaaaaagcagggcttgcgcgccgtgttgtatttttaaagccaaagatttgtgtgaagggttagtggaattttgaaataccaggagtgaaaaga
gcccagtggaaaaaggaaATG

    CBU1171 Gene: CBU1171     GI: 29654476     BI number: CBU1171     GOG: COG0432     Description: conserved hypothetical protein TIGR0014 ga a  a c  t gc ta ta gc at a  g g  a t  a a  a g  a       gc ta       t  g tg       t  c gc        cg ta        gc |  g       gc |  g      g  g a  g       at gc        cg at        gt at        at             gtatttttaaagccaaagatttgtgtgaagggttagtggaattttgaaataccaggagtgaaaagagcccagtggaaaaaggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0432 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................