                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=3 nt.   Size=25 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACCTTGCCCCATTCCATCCAGAAATAATACCATCATTAGCGAAAATAGAGTGGCTAT
CTTGGTATTAGATTTCATcgttaaaacttaattagtgggcctcgcaacgcgtatataactataacactctttccattatttccctaa
ttcctacacgacaatcgtgccaaggccgcacttttttgtttaagctttggctcgattgttctgatacttatagcagtagcccgtatgcagcgaagcggaa
tacgggagaactataagatttccccgtattacttcgctgcatacgggctacttttTTG

    CBU1207 --- CBU1206 Gene: CBU1207     GI: 29654510     BI number: CBU1207     GOG: -------     Description: hypothetical protein Gene: CBU1206     GI: 29654509     BI number: CBU1206     GOG: KOG1435     Description: c-24(28) sterol reductase, putativ   a         a g  a      t  a cg       a  g gc       t  a a  g      c  t c  g       at g  a       at ta        gc         c at       a  |      t  g ta        gc       t  c gc        gc       c  t cg        gc       a  g cg        cg       t  c cg        at        ta |  a       ta        at g  g       at        ta a  a       at        gc ta       |  a       cg gc        gc        cg at        gt        cg                         ctacttttTTG     ..................................................................................................................