                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-28.20 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G=-13.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cattgctagagacatgtagcaacttcttatctttctaattattggtaaagtattgttatataaaaagttaagaacgtattaattttgaattctttttgtg
gtgccccaaggcgattctaccaaagccgtagcccgtatggagcgaagcgaaatacgggtttgttattgcttcccgtatttcgcttcgctccatacgggct
tctttctaaggagtatcaaaaaattgggtatttttaagattgatttaatgtctggcggttagaattccttctatcggcgtttcccagtgagcagcttata
ATG

    CBU1213 Gene: CBU1213     GI: 29654516     BI number: CBU1213     GOG: -------     Description: ankyrin repeat domain protei            at           t  t            tg            gc           t  t           t  t           t  |   a        gc g  a       gc cg        gc         t gc        cg       t  c a  g       at        cg g  a       ta        gc g  a       at       c  t ta        at       t  c at        at       t  c ta        gc        ta gc        cg        at cg        gc        ta cg        at        gc cg        at        cg gt        gc        cg at        cg        cg                         cttctttctaaggagtatcaaaaaattgggtatttttaagattgatttaatgtctggcggttagaattccttctatcggcgtttcccagtgagcagcttataATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_burnetii                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.80 kcal/mol Antiterminator: Size=43 nt.     Delta G= -9.50 kcal/mol Anti-antiterminator:   Size=31 nt.     Delta G= -5.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case cattgctagagacatgtagcaacttcttatctttctaattattggtaaagtattgttatataaaaagttaagaacgtattaattttgaattctttttgtg gtgccccaaggcgattctaccaaagccgtagcccgtatggagcgaagcgaaatacgggtttgttattgcttcccgtatttcgcttcgctccatacgggct tctttctaaggagtatcaaaaaattgggtatttttaagattgatttaatgtctggcggttagaattccttctatcggcgtttcccagtgagcagcttata ATG     CBU1213 Gene: CBU1213     GI: 29654516     BI number: CBU1213     GOG: -------     Description: ankyrin repeat domain protei             a           a  g           a  c           c  c            cg            at ca        ta c  a       cg cg       t  c cg       t  c        a gc       a  |      g  a tg        gc        cg |  a       cg        gc |  t       gt       a  g |  t      g  a      g  a gc       a  |      g  a gt        at        ta ta        cg        at gc        cg        ta t  c      c  a       gc ta        cg        cg ta        gc        cg ta        tg        cg                         tttgttattgcttcccgtatttcgcttcgctccatacgggcttctttctaaggagtatcaaaaaattgggtatttttaagattgatttaatgtctggcggttagaattccttctatcggcgtttcccagtgagcagcttataATG     ..................................................................................................................