                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:157 nt.     Distance to run of Ts=2 nt.   Size=22 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-15.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTATCAAAAAAGAGCTGTGGATAATAGTTTTGCTGGCGTTACTTCATTAGGTGTTAAT
CGCCCGGTGGTTGATTTCATAGGGCTTGATTTAACTTACGAAAGTTAActctccaacctccggc
taaagccggaggtgcttctttgtctgtctttccttcacgatggcaatttctagctgagcatggtctactatggcgtgtatgtgagcagcggacctggaaa
tcaataggtcctggttgctttgagcagaaaagtacaatataaagtaacgttattgtcgaagtagaaggaggagagaaaATG

    mdh --- gcp Gene: mdh     GI: 29654544     BI number: CBU1241     GOG: COG0039     Description: malate dehydrogenase Gene: gcp     GI: 29654543     BI number: CBU1240     GOG: COG0533     Description: O-sialoglycoprotein endopeptidas GA T  T T  T GT GC TA GT        CG G  A      A  A CG        TA CG        TA CG        CG GC        AT |  T       AT |  T       TA CG        TA TA       T  c       aa AT        At       t  a AT        Gc        cg T  T      |  t       gc T  A      T  c       gc G  |      T  c       cg TA       C  a       cg GC       G  a       ta GT        Gc        cg AT        Gc        cg TA        At        at                         gcttctttgtctgtctttccttcacgatggcaatttctagctgagcatggtctactatggcgtgtatgtgagcagcggacctggaaatcaataggtcctggttgctttgagcagaaaagtacaatataaagtaacgttattgtcgaagtagaaggaggagagaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0039 Malate/lactate dehydrogenases ... can be seen here [O] COG0533 Metal-dependent proteases with possible chaperone activity ... can be seen here     ..................................................................................................................