                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:203 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.45 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAACAGAGTATGAAAGCGATGGGAATTAACGACCCCTATTTAACAATGAAAATTTCGC
AATAAAAACACCCCGGGGGCAAGCCCGGGGGTATTTTTATTCCTGGTAATATTTCGCC
TGCGCGAACAAGTTCGCGCGACGGCGACCCAAGGGGCGTGCTCGCACATTCCCCTTGG
GAAACCCCATGCGTAAGGTCCCGCGGCAAgccgcggggagtaaatttaaaatttcttcatctgatggcctttttccgtt
tggggaagaggaggggatagttgaaggaatgaagggagagaacctcaATG

    CBU1245 Gene: CBU1245     GI: 29654548     BI number: CBU1245     GOG: COG1160     Description: GTP-binding protei             T           T  C           T  G           A  C           A  A           A  A           A  T           G  A           T  A           A  A           A  A       CA   a       C  A      G  A a  c      A  C      G  G gc       A  A       GC at       T  C       GC gc       T  C       GC |  a      T  C       CG |  A      A  C       CG |  T       TG        CG a  G       CG        CG gC        CG       A  | gC        CG        CG gC        CG        AT                         ATTTTTATTCCTGGTAATATTTCGCCTGCGCGAACAAGTTCGCGCGACGGCGACCCAAGGGGCGTGCTCGCACATTCCCCTTGGGAAACCCCATGCGTAAGGTCCCGCGGCAAgccgcggggagtaaatttaaaatttcttcatctgatggcctttttccgtttggggaagaggaggggatagttgaaggaatgaagggagagaacctcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1160 Predicted GTPases ... can be seen here     ..................................................................................................................