                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-13.10 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -6.25 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTAGTTCTGTGGCTGTTAAGGTTCCGTCAAGCTCCAAAGGCTATATTCGACCGAAAGC
CGGCATCGGTGTGGGCTATAATATCACCCAGAACATTGGCGTTGATGTTTCCTACTCA
CGTGTCTTTGGTCAAGGGAAAATCAATAACACTAACTACTTGCCTAACTTGAACGCAG
TTACGCTGGGCTTAACTTACAAGTTCTAAggaacttaacacacaaaaaggggcttcgtgcccctttttttatattccca
catacgataggatttatcgaaattagatttcgacataggaagcgaacATG

    CBU1261 --- CBU1262 --- CBU1263 Gene: CBU1261     GI: 29654563     BI number: CBU1261     GOG: COG1686     Description: D-alanyl-D-alanine carboxypeptidase Gene: CBU1262     GI: 29654564     BI number: CBU1262     GOG: COG2921     Description: conserved hypothetical protein Gene: CBU1263     GI: 29654565     BI number: CBU1263     GOG: -------     Description: hypothetical protei   G T  G       AA CG       T  g GC        Cg C  T       Ta AT        Ta TA        Gc TA        At GC        At AT       |  a C  T      |  a G  A      |  c C  |      |  a A  |      |  c A  |      |  a GC       C  c TA       A  a TA       T  a        c CG       T  a      t  g AT       C  a      t  t AT       A  a       cg T  C      A  g       gc C  |       Tg        gc C  |       Tg        gc GT        Cg        gc TA        Gc        at TA        Gt        at Cg        Gt        at                         ttttatattcccacatacgataggatttatcgaaattagatttcgacataggaagcgaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1686 D-alanyl-D-alanine carboxypeptidase ... can be seen here [S] COG2921 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................