                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=2 nt.   Size=19 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccacaccaccatcagtattctttccgttcacttgcactatacatttatttgcctcagaagtcgcaagctatctatgccaacgggccgtgaagtcaggctc
catattttgtgcataggcagccatccctagaaacataagtacagcataactcattgaaatcaataaagttttaattactcacatttccgttacctccttt
tgcttaaaagcaatagaataaatatagctgtcctggtattttatgcaaatcccacattatgttacactgctctttttgggttggtggtgaaatgacagca
ATG

    greA Gene: greA     GI: 29654581     BI number: CBU1280     GOG: COG0782     Description: transcription elongation factor Gre ac a  g cg cg gc        ag t  c      a  t a  g       gc t  t       ta cg       g  | ta        cg a  |       cg ta        gc cg        gt gt        gc             catattttgtgcataggcagccatccctagaaacataagtacagcataactcattgaaatcaataaagttttaattactcacatttccgttacctccttttgcttaaaagcaatagaataaatatagctgtcctggtattttatgcaaatcccacattatgttacactgctctttttgggttggtggtgaaatgacagcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0782 Transcription elongation factor ... can be seen here     ..................................................................................................................