                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:212 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=15 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTATCGGGATCGTAAGCAGCGTAAGCGCCAATTTCGCGCTTTATGGATTGTCCGTAT
TAACGCAGCCGCGCGTGAGCATGGGCTTTCTTACAGCCGTTTGATTAATGGCTTAATG
AAAGCATCCGTTGCCATCGATCGTAAAAACTTAGCGGAATTAGCGGTGTATGATAAAG
CCGCTTTTGGAAAATTAGCAGAAAAAGCTAAGCAGGCCTTAGGCGGTTAAcgtttaaaccagt
cacccccgccagaccgtcgtccgcggtcaagttgtggatgacggataaatacaatggcgaagcATG

    pheS --- pheT --- ihfA --- CBU1319 Gene: pheS     GI: 29654620     BI number: CBU1322     GOG: COG0016     Description: phenylalanyl-tRNA synthetase, alpha subunit Gene: pheT     GI: 29654619     BI number: CBU1321     GOG: COG0072,COG0073     Description: phenylalanyl-tRNA synthetase, beta subunit Gene: ihfA     GI: 29654618     BI number: CBU1320     GOG: COG0776     Description: integration host factor, alpha subunit Gene: CBU1319     GI: 29654617     BI number: CBU1319     GOG: COG0789     Description: transcriptional regulato                      CC ga                 G  G c  a                A  C g  g                 CG gc                  GC tA                  CG a  |                 AT aT                 A  G cG                 T  A aT         T       T  G tA       T  G      A  C aT       A  T       TA a  G       GC        GT a  G       GC        CG tA        TG        CG aT        AT        TG gT        TA        GC                         TTTCTTACAGCCGTTTGATTAATGGCTTAATGAAAGCATCCGTTGCCATCGATCGTAAAAACTTAGCGGAATTAGCGGTGTATGATAAAGCCGCTTTTGGAAAATTAGCAGAAAAAGCTAAGCAGGCCTTAGGCGGTTAAcgtttaaaccagtcacccccgccagaccgtcgtccgcggtcaagttgtggatgacggataaatacaatggcgaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0016 Phenylalanyl-tRNA synthetase alpha subunit ... can be seen here [J] COG0072 Phenylalanyl-tRNA synthetase beta subunit ... can be seen here [R] COG0073 EMAP domain ... can be seen here [L] COG0776 Bacterial nucleoid DNA-binding protein ... can be seen here [K] COG0789 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................