                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=2 nt.   Size=38 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -5.83 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGGAATCCAGCGCGCTTTTAGCGCGCAGCGCACCCAGTGCGCTGGGTCCCCGCCTTC
GCGGGGACGACGGGGGTTTTTAGAAATTAAGACTAATAGAAAAAACAAGACAGAATGG
GAAGAATTCCCCACggtttgtttttaataatcgtgccctaagaataagactatctttgttgaccgttttaagttgacaacttaaaatggt
cgcaggtttattcatcgcgatatcgaatgcttagcagacgactccgcatagaatagggcctgattcatttgttaaaacctccataagcgtctccATG

    radA Gene: radA     GI: 29654714     BI number: CBU1422     GOG: COG1066     Description: DNA repair protein Rad cg t  t a  g a  c t  c a  c at ta ta tg ta ta gt ta |  a                  a |  g                g  c |  a                 ta |  c                 ta |  t                 gc |  a                 at |  t                 at |  c                 ta |  t                 ta |  t       tt        ta |  t      t  t       ta |  g      g  a       gt |  t      c  a       cg |  t       cg        cg tg        at        at ta       g  t       gc gc       t  g      t  | gc        ta        tg Cg        gc        gc At        ta        ta                         ggtttattcatcgcgatatcgaatgcttagcagacgactccgcatagaatagggcctgattcatttgttaaaacctccataagcgtctccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1066 Predicted ATP-dependent serine protease ... can be seen here     ..................................................................................................................