                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:111 nt.    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -7.20 kcal/mol
Antiterminator:    Distance from promoter:90 nt. Size=27 nt.     Delta G= -4.36 kcal/mol
Anti-antiterminator:    Distance from promoter:61 nt.    Size=35 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTTTC-TAGAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTTCAATAGATTAGGTAAGTTTAGAATACGGTTAAGCATTTTATAAACCACaacaaagt
tgctgattatcttaatatatagcgatagtgttgtgggttgtcaatcagctgtttcccctgcgatttcagatgttaaaacgtcgcactatcctaagtgggg
cctttttaattttgagttaatatttatacgctaggatgaaggaaaatgacgcaccgtgtgaaggagatcgtttATG

    CBU1457 Gene: CBU1457     GI: 29654748     BI number: CBU1457     GOG: COG0790     Description: conserved domain protei ca t  g a  c at cg         g |  t      t  t t  t      a  t g  t      g  a       cc t  c      a  a      t  t t  c      c  a      a  a gc       t  a       ta gc       t  c       cg g  t       tg        at t  g       at        cg gc        gc       g  g tg        cg        cg ta        gc        tg gt        ta        gc                         ctttttaattttgagttaatatttatacgctaggatgaaggaaaatgacgcaccgtgtgaaggagatcgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0790 FOG: TPR repeat, SEL1 subfamily ... can be seen here     ..................................................................................................................