                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

actctttagcaaagagggattatttctaccactttcgtttcattgcgatagcttatcgctctcggataattttatggcactcagtcttaaatgggaagat
caaaattttttacaagaactggattttatttgatcgagttgttcactgatacggtccaaaatgatttgaaatttcattgaggaagattgaacgaaaccat
tgcttgacagttatagaaagcagttggtataacctgagtagtcagggaggctgggcgaaacctgccttttgtcaattgatggaactaccgagaggaattt
ATG

    hupB --- CBU1463 Gene: hupB     GI: 29654755     BI number: CBU1464     GOG: COG0776     Description: DNA-binding protein HU-beta Gene: CBU1463     GI: 29654754     BI number: CBU1463     GOG: -------     Description: hypothetical protei            ta           g  g            at tt        gc g  a       ta a  t       cg c  a       cg a  g      a  g g  a      a  a ta       t  g ta       a  | cg        tg        ga gc        gc       c  a ta        gt       g  a tg        tg        gc |  t      t  g       gc at       g  |      t  t cg       a  |       cg cg        cg        gc at        gc        gc                         ttttgtcaattgatggaactaccgagaggaatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0776 Bacterial nucleoid DNA-binding protein ... can be seen here     ..................................................................................................................