                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:118 nt.    Distance to gene:97 nt.     Distance to run of Ts=3 nt.   Size=26 nt.     Delta G= -8.10 kcal/mol
Antiterminator:    Distance from promoter:94 nt. Size=39 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:    Distance from promoter:38 nt.    Size=59 nt.     Delta G= -8.51 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCT-TATTTT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCTTCCCCATGCCAATCGATATTTTAAAAATTTTCGAAAAGAAAGTAAGTGATTA
Attatgtagcccgtatgacgcgaacggaaggcagagggcagagggcagagggcagaagacagagggcagaagacagaagacagaagacagtggttgtgtc
gctacgcgacaactaaattttataaattaattgtggcgaagccacacgaacactgtcctctgtcctctgcctagggaatcacggtatttactcatttatt
tttcctttttactctttctcgATG

    CBU1481 --- CBU1480 --- CBU1479 Gene: CBU1481     GI: 29654772     BI number: CBU1481     GOG: -------     Description: conserved hypothetical protein Gene: CBU1480     GI: 29654771     BI number: CBU1480     GOG: -------     Description: hypothetical protein Gene: CBU1479     GI: 29654770     BI number: CBU1479     GOG: -------     Description: hypothetical protei   a g  g a  g cg gc g  a g  g a  a g  g a  g cg gc g  a       ga a  g      a  c a  a      a  a g  a      g  g g  g       at c  a       cg a  |      a  g a  |      g  | g  |       at c  |       at        gc g  |      g  g      c  t c  |       at        ta a  |       cg        gc gc        at        tg ta        gc        gc a  g      a  |       tg t  a      a  |       ta g  |      g  |       gc cg       a  |      g  a cg        cg        ta cg        gc        gc gc        gt        at                         aaattttataaattaattgtggcgaagccacacgaacactgtcctctgtcctctgcctagggaatcacggtatttactcatttatttttcctttttactctttctcgATG     ..................................................................................................................