Gene putatively regulated by attenuation in C_burnetii
Characteristics of the secondary structures
Terminator: Distance from promoter:63 nt. Distance to gene:73 nt. Distance to run of Ts=1 nt. Size=25 nt. Delta G= -9.50 kcal/mol
Antiterminator: Distance from promoter:17 nt. Size=51 nt. Delta G= -7.40 kcal/mol
Anti-antiterminator: Size=46 nt. Delta G= -6.70 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTGAAG-CAAAAT. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTGAAGCTCTGCAATGGGTTGTTCAAAATCTAAATAATCTAAGTTCATgactagcctgttatta
aaacgattacgcagttaacaacttcaaagtcattccattttcgccggaatgacgtgttttaaagttaaattacagttgttgacgtttatggtaatgtagc
agtttcattgcacttacgctagaggagtccctATG
CBU1511
Gene: CBU1511 GI: 29654802 BI number: CBU1511 GOG: ------- Description: transporter, ZIP famil
tt
a a
gc
AA cg
T T | c
A C a a
A T a g
A A at
TA at
CG ta
T T ta
A T a c
A C ta
A A ta t
AT gc t c
Cg t t t g
Ta c t t c
T c c c a c
Gt g a cg
Ta a a cg
Tg ta ta
Gc cg ta
Gc at at
Gt gc cg
Tg Ta ta
At At gc
gtgttttaaagttaaattacagttgttgacgtttatggtaatgtagcagtttcattgcacttacgctagaggagtccctATG
..................................................................................................................