                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:185 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -8.52 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACCCGGTAGATAATAGGGTCTTTATAATCGCGCCAAAATTGATGGACGGCTTTATGC
GACAGATCTGGCATgacttctccgctatttagggtctgtttacagacctaggctttttaagagaatagcccactaaccttaacgaaatat
taaggttccgttaaagcgctaccgcttttaatttttatttaagaaaatttcccaaaatctgcctttccttaatcaacccttaatactgtcttaaggaagt
ggtgctagcatgaatgaaaaatcccgtaatgattcttttggagtcttccccaATG

    CBU1649 --- CBU1648 --- CBU1647 Gene: CBU1649     GI: 29654939     BI number: CBU1649     GOG: -------     Description: IcmV protein, putative Gene: CBU1648     GI: 29654938     BI number: CBU1648     GOG: NOG39730     Description: DotA protein, putative Gene: CBU1647     GI: 29654937     BI number: CBU1647     GOG: -------     Description: hypothetical protei   G T  A T  T A  G A  G A  A A  C CG CG         t GC       c  t |  T      a  c |  T      g  t |  T      T  c |  A      A  c |  T       Cg        tt CG        Gc       t  a GC        Gt        gc CG       |  a       ta TA       |  t       cg A  C      |  t       ta A  |      |  t       gc T  |      |  a       gc A  |       Tg        gt T  |       Cg       a  a T  |       Tg       t  | TA        At       t  | CG        Gc       t  | TA        At       a  | GT        Cg        tg GC        At        cg GT        Gt        gc                         tttttaagagaatagcccactaaccttaacgaaatattaaggttccgttaaagcgctaccgcttttaatttttatttaagaaaatttcccaaaatctgcctttccttaatcaacccttaatactgtcttaaggaagtggtgctagcatgaatgaaaaatcccgtaatgattcttttggagtcttccccaATG     ..................................................................................................................