                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=3 nt.   Size=26 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-15.70 kcal/mol
Anti-antiterminator:   Size=62 nt.     Delta G=-23.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACGCCACATTTTGGAAATGGAAGGCGTCACTGGAGAAGAAGTGGAAGATTGAaaataaca
aaaaactattccctcttccgctcgcgggcccagtagctgtagcccgtatgagcgaagcgaaatacgggaaaacaaaatgtcgtttattgtccccgtattt
cgcttcgctcatacgggctactttttgaaagcctacacttttaatagctcctttaatccgccgttaacttgatttaatcgaatatgttttgtattttgca
tagagatccagcttatgaatagctatcgctgagtacattATG

    CBU1668 --- CBU1667 --- CBU1666 --- CBU1665 Gene: CBU1668     GI: 29654958     BI number: CBU1668     GOG: -------     Description: hypothetical protein Gene: CBU1667     GI: 29654957     BI number: CBU1667     GOG: -------     Description: hypothetical protein Gene: CBU1666     GI: 29654956     BI number: CBU1666     GOG: -------     Description: conserved domain protein Gene: CBU1665     GI: 29654955     BI number: CBU1665     GOG: -------     Description: hypothetical protei   a t  g gc at cg |  t c  a cg gc gc gc cg gt |  a        c |  t      t  g cg       g  t ta       t  t cg       a  t gc       a  a c  |       at cg        at ta        cg ta        at cg       a  c        t |  c      a  |      t  c |  g      a  |       cg |  a       gc        gc |  a       gc       c  t |  a       gc       t  c |  t       cg       t  | |  a       at        ta t  c       ta        at cg        at        ta cg        at        gc cg        at        cg ta        gc        cg ta        cg        cg                         ctactttttgaaagcctacacttttaatagctcctttaatccgccgttaacttgatttaatcgaatatgttttgtattttgcatagagatccagcttatgaatagctatcgctgagtacattATG     ..................................................................................................................