                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:88 nt.    Distance to gene:126 nt.     Distance to run of Ts=3 nt.   Size=22 nt.     Delta G= -6.40 kcal/mol
Antiterminator:    Distance from promoter:48 nt. Size=47 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:    Distance from promoter:11 nt.    Size=52 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaatt-taaaaT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaattttttcattttgcacttaataaaaTCATAAGGTCAATAAATTAATTTTTAAAAAATAAAATAATA
TTTCCTTAAGGGTTTTGAATTTATAAATAAATGGCTTTTTAATTCGTTTCACcctaaattt
atagggagaaaatatttttaatttgatttctttaaaaatgaataaattttttttattttctgcatcgtgaattaatattttttaaaaaataggttgataa
attttttgaattagtgtttttctattggggcattaaaaatttcttgagcacattcctttaATG

    CBU1683 --- pyrG Gene: CBU1683     GI: 29654973     BI number: CBU1683     GOG: -------     Description: hypothetical protein Gene: pyrG     GI: 29654972     BI number: CBU1682     GOG: COG0504     Description: CTP synthas AT A  A A  A AT        AT TA       A  G AT       A  G AT       T  C AT        AT |  C       AT A  C       AT AT       T  T AT       A  T TA       T  | TA        TA TG        TA TG        AT TG        AT AT        GC        tt AT        TG       a  t |  T      |  T      a  a |  T      |  T       at |  G      T  T       ta TA       T  C       cg TA        TA        cg AT        GC        Cg AT        Gc       A  a AT        Gc        Cg TA        At        Ta                         aaatatttttaatttgatttctttaaaaatgaataaattttttttattttctgcatcgtgaattaatattttttaaaaaataggttgataaattttttgaattagtgtttttctattggggcattaaaaatttcttgagcacattcctttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0504 CTP synthase (UTP-ammonia lyase) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_burnetii                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:86 nt.    Distance to gene:141 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -8.20 kcal/mol Antiterminator:    Distance from promoter:50 nt. Size=47 nt.     Delta G= -7.60 kcal/mol Anti-antiterminator:   Size=63 nt.     Delta G= -6.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttaatt-taaaaT. It has a score value of 66.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttaattttttcattttgcacttaataaaaTCATAAGGTCAATAAATTAATTTTTAAAAAATAAAATAATA TTTCCTTAAGGGTTTTGAATTTATAAATAAATGGCTTTTTAATTCGTTTCACcctaaattt atagggagaaaatatttttaatttgatttctttaaaaatgaataaattttttttattttctgcatcgtgaattaatattttttaaaaaataggttgataa attttttgaattagtgtttttctattggggcattaaaaatttcttgagcacattcctttaATG     CBU1683 --- pyrG Gene: CBU1683     GI: 29654973     BI number: CBU1683     GOG: -------     Description: hypothetical protein Gene: pyrG     GI: 29654972     BI number: CBU1682     GOG: COG0504     Description: CTP synthas   A A  A A  A AT TA TA TA TA T  T A  A A  A       GG T  T      T  C TA       A  T AT       A  T AT        AT AT        TT T  |       AT A  |      A  A A  |      A  A C  |      T  | T  |       AT GC        TT GC        TC        tt AT        TG       a  t AT        AT       a  a TA        AT        at |  A      |  T       ta A  G      |  C       cg CG       G  A       cg TG       T  C       Cg aT        Tc       A  a aT        Tc        Cg aT        Tt        Ta aT        Ga        Ta tG        Ga        Ta                         atatttttaatttgatttctttaaaaatgaataaattttttttattttctgcatcgtgaattaatattttttaaaaaataggttgataaattttttgaattagtgtttttctattggggcattaaaaatttcttgagcacattcctttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0504 CTP synthase (UTP-ammonia lyase) ... can be seen here     ..................................................................................................................