                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAATGAAAAGGCAATCGTTTCCCTTCAGTCGCTGAAATCGGACCCAAATATCCGCCTG
GATGTGTTCAACCATATGGCCCAAATGAATAGGCCCATTTGCGTAAGGCAAGGCGGCA
GTCACCAGAATTTGTCTTTTTTCTGTCGTCATggagcagacactatacctagtttggaccgaattttcatcatttt
ggcagggtctgaaggctctgttttttaatacgttacatccaactttaatccagttttaattgggttcatccaatagagtgaaacagtatttatattcaag
gaaaaacaTTG

    CBU1694 Gene: CBU1694     GI: 29654983     BI number: CBU1694     GOG: -------     Description: hypothetical protei            at           c  t           t  t            at            cg ta        tg a  c      t  c t  c      t  a c  t      t  g a  a      a  | cg       a  |       ga at       g  |      t  a gt        cg        cg at        cg        tg cg        at        gc g  g       gc        gt a  a      g  t       gc gc       t  g       at gc        ta        cg Tg        ta        gt                         tttttaatacgttacatccaactttaatccagttttaattgggttcatccaatagagtgaaacagtatttatattcaaggaaaaacaTTG     ..................................................................................................................