Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:72 nt.    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G= -9.60 kcal/mol
Antiterminator:    Distance from promoter:75 nt. Size=18 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCAA-TAATAT. It has a score value of 74.3 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCAATATCAACACCCAGTATTTTAATATCTTTCATggaccttctcctttttttgaaaatagaaattctatg
ttggcgcattatgacgccgtctttaaggggtgggtccatttcattgggctactggttgaaaacctacatttttaatcgcatccgcttcgatctcaccata
tagcaaaacctatttaaggcgtgtatattaaaaccctttttatggcagtgctcagggagcagtaaggaaactgagagaggaattttgttGTG

    CBU1699 --- CBU1698


Gene: CBU1699     GI: 29654988     BI number: CBU1699     GOG: -------     Description: conserved hypothetical protein
Gene: CBU1698     GI: 29654987     BI number: CBU1698     GOG: COG1373     Description: conserved hypothetical protei



           ct
          g  a
           gc
           gt
           tg
           tg
          |  t
           at
           cg
           ta
           ta
           ta
 tc       a  |
t  a      c  |
t  t      c  |
 at        ta
 cg        gc
 cg        gc
 tg        gt
 gc        ta
 gt        gc
            atttttaatcgcatccgcttcgatctcaccatatagcaaaacctatttaaggcgtgtatattaaaaccctttttatggcagtgctcagggagcagtaaggaaactgagagaggaattttgttGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1373 Predicted ATPase (AAA+ superfamily) ... can be seen here

    ..................................................................................................................