Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:90 nt.    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.70 kcal/mol
Antiterminator:    Distance from promoter:51 nt. Size=50 nt.     Delta G= -4.86 kcal/mol
Anti-antiterminator:    Distance from promoter:7 nt.    Size=55 nt.     Delta G= -7.23 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgggt-tatttt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgggttttaagctttggtactattttgtctttcagtcacgccccccattttaaccatcttggctttactttttttcaagggattgactttttaacttca
gatattatgctgccactcagcggtcttttaatcgctgttttttctggctggttattgccaacaacgctcattcaaaaaacgttgggttggaatccgcata
atttttggtttcggtgttggcgatggagtaagcgttattttgcccctatcgccattggtttaattttactgatgtctttgagaattttataATG

    CBU1732


Gene: CBU1732     GI: 29655020     BI number: CBU1732     GOG: COG0111     Description: D-isomer specific 2-hydroxyacid dehydrogenase family protei


 ac
a  c
t  a
t  t
t  c
t  t
 at
 cg
 cg        tt
|  c      a  a
|  t      t  t
|  t      a  g
|  t       gc
|  a       at
|  c       cg
|  t      t  c
|  t      t  c
|  t      c  a
|  t      a  c
|  t      a  t
|  t      t  c
|  t      t  |
|  c      t  |
|  a      t  |
c  a       ta
 cg        cg        tt
 cg       a  |      t  t
 cg        gc       c  a
g  a       tg        ta
c  t       tg        gt
 at        at        gc
 cg        gc        cg
 ta        gt        gc
 gc        gt        at
 at        at        cg
                        ttttttctggctggttattgccaacaacgctcattcaaaaaacgttgggttggaatccgcataatttttggtttcggtgttggcgatggagtaagcgttattttgcccctatcgccattggtttaattttactgatgtctttgagaattttataATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[HE] COG0111 Phosphoglycerate dehydrogenase and related dehydrogenases ... can be seen here

    ..................................................................................................................