Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:117 nt.    Distance to gene:102 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -8.30 kcal/mol
Antiterminator:    Distance from promoter:78 nt. Size=47 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCCA-tagaGT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCCACATGGTCAAagtctaacgtagaGTGTTAAAGTGTCAAGCAAGGGGAGCGGCCTGTTG
TACTCATATCATTACCCACAATGCCCGTCGTTCCCGTGACTTCGGCCGTGAAGGTTTT
GTATCTTTCAATAATACAGCGGACGGCCTCGCGGGAGGACGACGGGGGGTTTTTGAAA
TTAAGGCTAATAAATAGaaaaaataatctagaatgggaagatttataataaggttttgttgttaatcgtcatttatatattgaaatgg
ctgtgacttaATG

    CBU1739


Gene: CBU1739     GI: 29655027     BI number: CBU1739     GOG: COG0313     Description: tetrapyrrole (Corrin/Porphyrin) methylase domain protei


  C
T  A
T  A
T  T
C  A
 TA
 AT
 TA
 GC
 TA
 TG
|  C
|  G
|  G
|  A
|  C
 TG        AG
 TG       G  G
 GC       G  A
 GC        GC
A  |       CG
 AT       |  A
 GC        GC
 TG        CG
 GC        TG
 CG        CG
 CG        CG
            GGTTTTTGAAATTAAGGCTAATAAATAGaaaaaataatctagaatgggaagatttataataaggttttgttgttaatcgtcatttatatattgaaatggctgtgacttaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0313 Predicted methyltransferases ... can be seen here

    ..................................................................................................................