Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:75 nt.    Distance to gene:72 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -6.70 kcal/mol
Antiterminator:    Distance from promoter:69 nt. Size=16 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:    Distance from promoter:32 nt.    Size=47 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCAA-TAATAT. It has a score value of 74.3 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCAATATCAACACCCAGTATTTTAATATCTTTCATggaccttctcctttttttgaaaatagaaattctatg
ttggcgcattatgacgccgtctttaaggggtgggtccatttcattgggctacttttataaaaaagaatttcaaatgttaactttttcttaacttaaaagt
ggtaaactctttactaaaagggaggtttttATG

    CBU1758


Gene: CBU1758     GI: 29655046     BI number: CBU1758     GOG: -------     Description: hypothetical protei


 ta
t  t
a  g
c  a
 gc
 cg
 gc
 gc
 tg
|  t
|  c
|  t
t  t
 gt
 ta
a  a
 tg
 cg                  tc
 tg        gt       t  a
 tg       g  c      t  t
 at        gc        at
|  g       ta        cg
|  g       gt        cg
a  g       gt        tg
 at        gt        gc
 gc        gc        gt
                        acttttataaaaaagaatttcaaatgttaactttttcttaacttaaaagtggtaaactctttactaaaagggaggtttttATG


    ..................................................................................................................