                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-21.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATAAGCGGTTTTGCGCGATTCCAACGTTTTTTTTGGAGCGCGTGTCTATCTTCAGCT
AGATCATAGTTAAAATAGTCGTAGTTGTTGCGAAATTGCTTTGCCAAGGTGGTTTTAC
CACTTTGGCGTGGCCCGCTAAGTAAAACGATTTTATGAGGCAAGTCTTTTTCAATATT
TTCAGTTAAATAACGTTTCATaagaccattatgactcaaatgtcggaatagtcgagccacctcgttgactcttatgccgatatcc
accaagatagacgccagttctttactgtaaggaaaataggtATG

    glmS --- CBU1788 Gene: glmS     GI: 29655075     BI number: CBU1787     GOG: COG0449     Description: glucosamine--fructose-6-phosphate aminotransferase, isomerizing Gene: CBU1788     GI: 29655076     BI number: CBU1788     GOG: NOG40611     Description: conserved domain protei             G           G  C   T       T  C T  T       GC T  A       CG GC        GC GC        GT TA        TA GC        TA GT       T  | AT       C  | AT       A  | CG       C  | CG        CG GC        AT TG        TA T  T       TA TG        TA CG        TA GC        GC             GATTTTATGAGGCAAGTCTTTTTCAATATTTTCAGTTAAATAACGTTTCATaagaccattatgactcaaatgtcggaatagtcgagccacctcgttgactcttatgccgatatccaccaagatagacgccagttctttactgtaaggaaaataggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0449 Glucosamine 6-phosphate synthetase, contains amidotransferase and phosphosugar isomerase domains ... can be seen here     ..................................................................................................................