                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:176 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-13.30 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGAGCTCTTTTTCAAAAACAATGAGATGAGCAGTCAGGCGACGAATATTTTTCTTT
GTGGCGGTGATGCTCAATAAATTTTCCAGAATTTCTTGAGCCATGCACTTCATgagctcct
tttcttcgtgcttgcaagtgtcaccaatttcctcctggttatatttttgccaataagagctttatcttttcttgtatcttgtgtaaactcaaaatggctt
tttgtaactagtatatgttccttaaagaacagcgtcaacccgtagctctgaatcaattaagggaaaatacagatagtaacaATG

    CBU1802 --- CBU1801 --- CBU1800 --- CBU1799 Gene: CBU1802     GI: 29655089     BI number: CBU1802     GOG: -------     Description: hypothetical protein Gene: CBU1801     GI: 29655088     BI number: CBU1801     GOG: -------     Description: hypothetical protein Gene: CBU1800     GI: 29655087     BI number: CBU1800     GOG: COG1738     Description: membrane protein, putative Gene: CBU1799     GI: 29655086     BI number: CBU1799     GOG: COG0454     Description: acetyltransferase, GNAT famil TT T  T       CC A  T      T  A T  C       TG AT        TA AT        TA GT        AT CG        AT AT        AT G  G      T  C CG        AT GC        AT |  G       CG         C G  G       TA       A  T AT        CG       C  T CG        GC        GC TA       |  C       TA G  |      |  A       AT AT       T  T       Cg CG       A  G      |  a GC        GC        Cg AT        TA        Gc GC        GC        At TA        GT        Gc                         cttttcttcgtgcttgcaagtgtcaccaatttcctcctggttatatttttgccaataagagctttatcttttcttgtatcttgtgtaaactcaaaatggctttttgtaactagtatatgttccttaaagaacagcgtcaacccgtagctctgaatcaattaagggaaaatacagatagtaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1738 Uncharacterized conserved protein ... can be seen here [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here     ..................................................................................................................