                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:69 nt.    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.60 kcal/mol
Antiterminator:    Distance from promoter:26 nt. Size=51 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tgtaaa-tagtat. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgtaaattcacgtaaatttacgctagtatccttcattgtatgttgcttatagcctgcctatcattgctcggatacagtcttttactgtgccgcttcattc
gttggccaattgagtcaacgattttctttattgtttcggcaattattgtcattaactatatcgctgcttatttcggtttattgcaacccatcagtgaggg
gttactatggATG

    CBU1851 --- CBU1852 Gene: CBU1851     GI: 29655136     BI number: CBU1851     GOG: NOG41470     Description: hypothetical protein Gene: CBU1852     GI: 29655137     BI number: CBU1852     GOG: COG1807     Description: hypothetical protei   t t  t c  t ta gc at cg at tg a  | gc gc cg |  c t  t c  t        t gc       a  t ta       a  g t  t      c  a a  t       cg c  c       gt t  g       gc a  t       ta t  t       ta cg        gc cg        cg gc        ta             ttttctttattgtttcggcaattattgtcattaactatatcgctgcttatttcggtttattgcaacccatcagtgaggggttactatggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1807 4-amino-4-deoxy-L-arabinose transferase and related glycosyltransferases of PMT family ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_burnetii                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:69 nt.    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.60 kcal/mol Antiterminator:    Distance from promoter:31 nt. Size=51 nt.     Delta G=-12.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tgtaaa-tagtat. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tgtaaattcacgtaaatttacgctagtatccttcattgtatgttgcttatagcctgcctatcattgctcggatacagtcttttactgtgccgcttcattc gttggccaattgagtcaacgattttctttattgtttcggcaattattgtcattaactatatcgctgcttatttcggtttattgcaacccatcagtgaggg gttactatggATG     CBU1851 --- CBU1852 Gene: CBU1851     GI: 29655136     BI number: CBU1851     GOG: NOG41470     Description: hypothetical protein Gene: CBU1852     GI: 29655137     BI number: CBU1852     GOG: COG1807     Description: hypothetical protei   t c  g a  t tg tc tc tg cc tt g  | at cc aa |  t t  t a  c        t gg       a  t gt       a  g c  t      c  a t  g       cg c  g       gt g  c       gc t  c       ta t  a       ta aa        gc ct        cg t        ta             ttttctttattgtttcggcaattattgtcattaactatatcgctgcttatttcggtttattgcaacccatcagtgaggggttactatggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1807 4-amino-4-deoxy-L-arabinose transferase and related glycosyltransferases of PMT family ... can be seen here     ..................................................................................................................