Gene putatively regulated by attenuation in C_burnetii
Characteristics of the secondary structures
Terminator: Distance to gene:158 nt. Distance to run of Ts=0 nt. Size=35 nt. Delta G=-10.40 kcal/mol
Antiterminator: Size=67 nt. Delta G=-25.30 kcal/mol
Anti-antiterminator: Size=59 nt. Delta G=-18.00 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
aggccgtctaccgataataaagaatcgagcgctttcacggccgaagtcacgggaatcccggctaaaagcctaagaaaagcgcatcggtgtttttcttagc
cccttaatctgggtcctcccgactcggccgtgaaggttttttgtatacttcaataatatagcagacgacctcgcgggaggacgacgggttttaagttttc
cacgcttcaccacgagtgggtaatgatagctaccgagtccgtcttgcctctctagctacttcgTTATAATATGATAATTTGCATT
GTCTGAGGGGGCCCCATG
CBU1869
Gene: CBU1869 GI: 29655154 BI number: CBU1869 GOG: ------- Description: hypothetical protei
tc
a g
cg
a gt
a t cg
gc gt
gc at
gc at
cg at
a | at
c | gc
tg at
gc at
at ta
| a cg
a a | c
g a | c
c a c c c
cg gc t c
gc at c c
gc at cg
| t a a ta
c a a a gc
a a t t gt
cg c | gc
ta gc tg
| a gt cg
ta cg | c
ta cg | c
cg cg t g
gc t | a t
cg a | a g
gc at ta
| a gc ta
at gc cg
gc gt cg
ttttttgtatacttcaataatatagcagacgacctcgcgggaggacgacgggttttaagttttccacgcttcaccacgagtgggtaatgatagctaccgagtccgtcttgcctctctagctacttcgTTATAATATGATAATTTGCATTGTCTGAGGGGGCCCCATG
..................................................................................................................