                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:103 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGCCTTAGTAAAATTACTGGTGGACCCTTTGAGTCTTCAATACCTTCAAGGGGCCG
AAATTGATTACCGCGAAGATGTCAGCGGCGCTCAATTCGTCATCCGCAACCCAAACGC
CAAAACCACCTGCGGCTGCGGTTCCTCCTTCGCCGCCTGAtcacaattctcctctttccgggagccagcg
gccctggtttttaaaagcccagccttccctgaaaagcacactctaaaaaagggctaggaacttgattttaaccaggttaaaataaggctaaccaaatatt
accctggttaatttATG

    CBU1877 Gene: CBU1877     GI: 29655162     BI number: CBU1877     GOG: COG1373     Description: conserved domain protei            tt           t  c           c  c            tg            cg            cg            ta            cg           t  c           t  |   C       a  | T  C      a  | T  T      c  |        g GC       a  |      a  c GC       c  |       cg C  T      t  |       cg G  T      A  |       gc T  C       Gc       a  | CG        Ta        gc GC       C  |       gc GC        Cg        gt CG        Gc        cg GC        Cg        cg                         tttttaaaagcccagccttccctgaaaagcacactctaaaaaagggctaggaacttgattttaaccaggttaaaataaggctaaccaaatattaccctggttaatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1373 Predicted ATPase (AAA+ superfamily) ... can be seen here     ..................................................................................................................