                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAAATGATCGCCGCATCACGATAACATTCCGTTAAATTTTTACACAATGAAACGTTA
CTGTATGCCGAATCAGAAAAACCAGCGCCTTCGCCAGCGCCGGCTTGCAATCGTATTT
CGATGTCTCGTTGTATTAATCGTGGCGCCAAGGTCGGCGTAATCGCCACGCGTTTTTC
TTCTTCATTCCATTCACGAGTTACGGCAATAGTAATTGCCATtgtggtcctctcctggttaaaattcgt
atcatactgtttagttcgctcgaggtcgaggattgaattaatgatcagggaggaagaATG

    CBU1954 Gene: CBU1954     GI: 29655237     BI number: CBU1954     GOG: COG1809     Description: hypothetical protei GT T  C AT GC CG T  T T  T       GG TG       A  T AT       A  C TA        CG GT        CG |  T       GC C  A      |  G T  A      |  T A  T      |  A A  C      |  A CG       |  T GT       |  C TG        CG TG        GC |  C       GC CG        TA GC        GC GC        CG             CGTTTTTCTTCTTCATTCCATTCACGAGTTACGGCAATAGTAATTGCCATtgtggtcctctcctggttaaaattcgtatcatactgtttagttcgctcgaggtcgaggattgaattaatgatcagggaggaagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1809 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................