                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=73 nt.     Delta G=-39.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcacggccgaagtcacgggaatcccggctaaaaggctaagaaaagcgccatcggtgtttttcttagcctcttaatctggatcctcccgactcggccgtga
gggttttgtgtttttcaatactacagcagacggcctcgcaggaggacgacggtgttaagtttttaaggagctttgaaaaaaacaaagcgaaagagagcat
caactttacagtcattagaattttatgcttaagttgacgcctatgcgcaaaggcgggaatgacggataaaggagaatgacgggttaaaaaaggataaatt
ATG

    pntAB --- pntB --- CBU1958 Gene: pntAB     GI: 29655239     BI number: CBU1956     GOG: COG3288     Description: NAD(P) transhydrogenase, alpha-2 subunit Gene: pntB     GI: 29655240     BI number: CBU1957     GOG: COG1282     Description: NAD(P) transhydrogenase, beta subunit Gene: CBU1958     GI: 29655241     BI number: CBU1958     GOG: -------     Description: hypothetical protei   t a  c cg cg gt cg gt at at at at gc at at ta cg gc gc at a  c at at ta c  a        c gt       t  g gc       c  g c  t      a  c cg        gc cg        cg ta       c  t at        cg |  c       ta |  c       cg at        cg gc        tg gc        at gc        gt cg        gt             tgtgtttttcaatactacagcagacggcctcgcaggaggacgacggtgttaagtttttaaggagctttgaaaaaaacaaagcgaaagagagcatcaactttacagtcattagaattttatgcttaagttgacgcctatgcgcaaaggcgggaatgacggataaaggagaatgacgggttaaaaaaggataaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG3288 NAD/NADP transhydrogenase alpha subunit ... can be seen here [C] COG1282 NAD/NADP transhydrogenase beta subunit ... can be seen here     ..................................................................................................................