                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:126 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-18.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAATTAACGACAAAGATTCTTTTTTAATGGCGCGTCGTTTAATTCGTGAAGAGGGGC
TCTTAGTGGGCGGCTCTTCCGGATCAGCTGTTTGGGCGGCTTGCCAAGCGGCTCAACG
ATTGAAAGAAGGCGAACGATGTCTGGTTATTTTGCCGGATGCTATTCGAAATTATTTG
ACTAAATTTGTAGACGACGCCTGGATGAAGGCGCAAGGGTTTTTGTAAcgtattttcgatctta
acaatttcccgtatttcgcttcgctgcatacgggctactcttcttttgacgggataaaaaagGTG

    metC Gene: metC     GI: 29655306     BI number: CBU2025     GOG: COG0626     Description: cystathionine beta-lyas TG T  G TG GC TG        AA CG       G  A GC        TG AT        TA C  T      |  A T  G      |  G       TT A  |      A  G      A  T GC        GC       T  T GC        CG        TG C  A      A  A       GC C  |      A  A       GC T  |      C  C       TG T  |      T  G       CG C  |      C  A       TA TA       G  |       GT CG        GT        TG GC        CG       A  C G  G      G  T      G  T CG       A  C      C  A GC        AT        AT GT        CG        AT GC        CG        GC TA        GT        CG                         AAATTATTTGACTAAATTTGTAGACGACGCCTGGATGAAGGCGCAAGGGTTTTTGTAAcgtattttcgatcttaacaatttcccgtatttcgcttcgctgcatacgggctactcttcttttgacgggataaaaaagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here     ..................................................................................................................