Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:155 nt.    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.30 kcal/mol
Antiterminator:    Distance from promoter:129 nt. Size=35 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tagtct. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaaatcggaactttgtgttagtctaacaaaactcacaacctcgaagaaaaaaaggagtgtgctaatggataagcgttaggtatccgttctttctta
tttattattatttctttattttttctttgtcttgacccaataattttcgcctcctctcctcttccctgcgtatcatttacaacagaaacgggtgtttggt
caccctcttttattttaaaaaataattgcggtgaatccttagaaATG

    CBU2044


Gene: CBU2044     GI: 29655323     BI number: CBU2044     GOG: -------     Description: hypothetical protei


  a
c  t
t  t
 at
 ta
 gc        tg
|  a      t  g
c  a      t  t
 gc        gc
 ta        ta
 cg        gc
c  a       gc
c  |       gc
 ta       c  |
 ta       a  |
c  c      a  |
 tg        at
 cg        gc
 cg        at
            tttattttaaaaaataattgcggtgaatccttagaaATG


    ..................................................................................................................