Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=3 nt.   Size=19 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATACCGCGATGGTTGTATAAACGGTTAGAGTCTTATAAAAATGATAAAGCTTCATTGA
AGGCTTACGGCGTTGAAGTGGTAACGAAACTTTGTGAAGATTTAATCGCTTACGGGGT
CCCGGGGCTTCATTTTTACACTTTAAATCAATGTGAACCTACCCAAACCATTATTGAA
AACCTTCAATCCATCACCTCTTTCCGTGAACAAGCGGTTGTTGCCTGAataaaaaattcacgat
ataaattttcccgctctaggttgtttttttattagtcttaatttccaaaaccagcgcactgcGTG

    CBU2046


Gene: CBU2046     GI: 29655325     BI number: CBU2046     GOG: -------     Description: hypothetical protei


 TG
T  A
G  A
 CG        GT
 GT       T  G
G  G       TA
 CG        TA
 AT        CG
 TA       A  A
 TA        AT
C  C       AT
G  |       GT
G  |      C  A
A  |      A  |
A  |      A  |
G  |       TA
T  |       GT
T  |       GC
A  |       TG
 CG        GC        GT
 TA        AT       G  C
 TA        AT        GC
C  A      |  A       GC
 GC        GC        CG
 AT        TG       A  |
 AT        TG        TG
 AT       G  G       TG
 TG        CG        CG
 AT        GT        GC
                        TTCATTTTTACACTTTAAATCAATGTGAACCTACCCAAACCATTATTGAAAACCTTCAATCCATCACCTCTTTCCGTGAACAAGCGGTTGTTGCCTGAataaaaaattcacgatataaattttcccgctctaggttgtttttttattagtcttaatttccaaaaccagcgcactgcGTG


    ..................................................................................................................