                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:67 nt.    Distance to gene:59 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:50 nt. Size=31 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:    Distance from promoter:41 nt.    Size=26 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCAT-tagaat. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCATTTTTCTTCATAAgtcactagaattctcatcaaatatcacgggcctatcggcataatcccatcgctttcaagtttgctccta
actatgagatatcagctggagtatcgcattatgagctgatgcttgtttgggatgggcggcatgtattttaatttaaacaatcattaaagaggttttatca
taacttATG

    rho Gene: rho     GI: 29655364     BI number: CBU2086     GOG: COG1158     Description: transcription termination factor Rh            at        gc           g  a      c  a            at       t  t   t        gc        at c  c       ta        ta g  c      a  g       gt t  t      t  c      a  g ta       c  t      g  | ta       a  |      g  | gc       a  |       ta at       t  |       cg |  a       cg        gc at        cg        at cg        ta        cg ta        cg        ta tg        gt        at ta        ta        tg                         cttgtttgggatgggcggcatgtattttaatttaaacaatcattaaagaggttttatcataacttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1158 Transcription termination factor ... can be seen here     ..................................................................................................................