                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAAACGTTGGATTATATTTATCGCCGTATACCGATAAACTTTTAATTTTGCTTGAGG
CGTCCGCCTTAACTTCCAATGGCTGAACGGTTCCTTCGATGGGTATTCATAGAAGAAA
TATACCAAAAGATTGTTTTAATGTCCAAATATTCATATCAAAAACGTGATTTTTATCA
CATTTTCTATATGAAAAATGTGATTTATTTCACAATTTTTAAAGGAATCCCTGACGCT
TACGGCCGAGATTTTTAAagttgacgcattcagataccggcagtatgatgcctttctatgctaggcagCGG

    _v19 Gene: _v19     GI: tRNA-Pro-2     BI number: tRNA-Pro-2     GOG: -------     Description: tRNA-Pr TT T  T TA         T AT       A  A GC       T  T TA        CG GC        TA C  A      |  A AT        TA AT        TA AT        TA AT        AT A  C       CG C  T       AT TA        CG AT        TA TA        AT             TTATTTCACAATTTTTAAAGGAATCCCTGACGCTTACGGCCGAGATTTTTAAagttgacgcattcagataccggcagtatgatgcctttctatgctaggcagCGG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_burnetii                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.20 kcal/mol Antiterminator: Size=34 nt.     Delta G= -4.50 kcal/mol Anti-antiterminator:   Size=56 nt.     Delta G= -5.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAAAACGTTGGATTATATTTATCGCCGTATACCGATAAACTTTTAATTTTGCTTGAGG CGTCCGCCTTAACTTCCAATGGCTGAACGGTTCCTTCGATGGGTATTCATAGAAGAAA TATACCAAAAGATTGTTTTAATGTCCAAATATTCATATCAAAAACGTGATTTTTATCA CATTTTCTATATGAAAAATGTGATTTATTTCACAATTTTTAAAGGAATCCCTGACGCT TACGGCCGAGATTTTTAAagttgacgcattcagataccggcagtatgatgcctttctatgctaggcagCGG     _v19 Gene: _v19     GI: tRNA-Pro-2     BI number: tRNA-Pro-2     GOG: -------     Description: tRNA-Pr   A A  A C  A C  G A  A T  T AT TG AT AT AT GT A  A A  A       TA G  |      A  T AT        CC         T TG        TA       A  A AT        TA       T  T |  C       AA        CG |  C       TA        TA C  A      A  A      |  A TA        AC        TA TA        AG        TA AT        CT        TA TA        CG        AT GT       T  A       CG GT       G  T       AT GC        TT        CG TA        AT        TA AT        AT        AT                         TTATTTCACAATTTTTAAAGGAATCCCTGACGCTTACGGCCGAGATTTTTAAagttgacgcattcagataccggcagtatgatgcctttctatgctaggcagCGG     ..................................................................................................................