                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=63 nt.     Delta G=-19.70 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGATGCCCTCTTATGGGTTCAAGGTGAGCCGGAAGCGCCAACTCAATGCTCGCTTTCT
CCTATTCCCAGCGCAAAAGACTACATGGCGGCTCTCGCCGTCCAAGTCCCAATCAAAA
CCATCCATTATTTTGATTGGGCCCCAGACTGAccaaagcctttctttttccacattcaggttgacatccactgcat
tgttacgcacaatatcacgcttgatttttgaggcgatttgtgtatggcatcggtgaaaaagcccgacagggttctttcattttttgatttgagtgggtaa
gcgtatttGGA

    CBU0221 --- _v10 --- _v11 Gene: _v10     GI: tRNA-Tyr-1     BI number: tRNA-Tyr-1     GOG: -------     Description: tRNA-Tyr Gene: _v11     GI: tRNA-Gly-1     BI number: tRNA-Gly-1     GOG: -------     Description: tRNA-Gly Gene: _v12     GI: tRNA-Thr-3     BI number: tRNA-Thr-3     GOG: -------     Description: tRNA-Th            tt           t  t           a  t           g  g            ta            tg            cg            gc            cg           a  a gt       c  t t  t      t  | t  a      a  | a  c      t  | cg        at gc        at ta        cg c  c       at a  a       cg c  |      g  t c  |      c  a       ac ta        at       g  a at        tg        cg c  a       tg        cg at        gc        cg gc        ta        gt ta       t  t       at |  c      a  |      a  c tg       c  |       at gc        gc        at gt        tg        at at        cg        gc cg        at        ta ta        cg        gt                         tttttgatttgagtgggtaagcgtatttGGA     ..................................................................................................................