                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:118 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTCGGGCAGCTTCAGGTCGCGCAGGACGCGGCTCTTGTCGGCGCGGCCCCGGGCGAG
GAGTTCCACCTCGGTGCGCTGGGCGGGGGTGAGTTCGGGCTGGGTCATgccgagcaggatagcc
cggaggctgaaaggggaggggtgaaggggtgatttaccattctataaactccggttttctaggtcggtctgggaattatcgtttttatgggtaaaatccc
tctgaactcggcataaacatgaaagcctgggtttgacattttggtaattccatgtttctattctcttaaggaggcaccATG

    DR0019 --- DR0018 --- DR0017 Gene: DR0019     GI: 15805060     BI number: DR0019     GOG: -------     Description: hypothetical protein Gene: DR0018     GI: 15805059     BI number: DR0018     GOG: -------     Description: hypothetical protein Gene: DR0017     GI: 15805058     BI number: DR0017     GOG: COG3877     Description: conserved hypothetical protei aa g  a tg cg        tt g  g      t  a g  g      a  c a  a       gc g  g       ta g  |       gt cg        gt cg        gc cg        gt gt       |  a a  g      a  t t  a      a  a a  a      g  a g  g       ta g  g       gc a  g       gt cg        gc gt        gc             ggttttctaggtcggtctgggaattatcgtttttatgggtaaaatccctctgaactcggcataaacatgaaagcctgggtttgacattttggtaattccatgtttctattctcttaaggaggcaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3877 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................