Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=78 nt.     Delta G=-22.40 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGCGGGTTCAAATCCCGTCCGGACCGccaaagtctccccctggggagcacGGCTAGGTAGCTCAGCT
GGTAGAGCAAACGACTGAAAATCGTTGGGTCGCCGGTTCAAGTCCGGCCCTGGCCAcc
aaacgagaactcctctgtccctggcaggggattttttgttttccccatgtatgtcagcttttcagaggcccccgtagagttggggacatggacagcgctc
tcccagaatttccaacttcatccagacagcttgccgaccctacccaagtagagcagcgccgctcctagctcactTTG

    DR0022


Gene: DR0022     GI: 15805063     BI number: DR0022     GOG: -------     Description: conserved hypothetical protei


            A
          C  A
          T  G
          T  T
           GC
           GC
           CG
           CG
           GC
          |  C
          |  C
          |  T
           CG
           TG
           GC
           GC
          |  A
          |  c
          |  c
 CG       G  a
A  A       Ta
A  C       Ta
 AT        Gc
 CG        Cg
G  A       Ta
A  A      |  g
G  A      A  a
A  |      A  a
 TA       A  c
 GT        At
 GC        Gc
T  |      T  |        c
 CG       C  |      c  t
 GT       A  |      c  g
 AT       G  |       tg
 CG       C  |       gc
 TG       A  |       ta
 CG       A  |       cg
 GT       A  |       tg
A  C      C  |       cg
T  G       Gc        cg
 GC        At        ta
 GC        Gc       c  |
A  |       At        at
 TG        Tg        at
 CG       |  t       gt
 GT        Gc        at
 GT        Gc        gt
                        tgttttccccatgtatgtcagcttttcagaggcccccgtagagttggggacatggacagcgctctcccagaatttccaacttcatccagacagcttgccgaccctacccaagtagagcagcgccgctcctagctcactTTG


    ..................................................................................................................