                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-16.20 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCGGTCGCGCTGTCCTCGGTGTGGGTGTTGGCGTAGAGCGGCAGCGCGAGCCGGCG
CACCTGGTCTTCTACGCTGCGCAGCGCCCGGCCCGAGGCCACGTAGTCGGCGTAAGTG
ACCCGCCGCTCGCCGAACGGGGTGCGGATGACGGCCTCCGACCCGATGAGGTCGGCCC
TTAAGCTGGCGAAGTCCATGCCGCTATTGTGAGCCCTAAGAGTGGCCAGGTCCACaatt
caggaggggctggcgctcctacgcacagcacgtttattaggcgctcaggccgctacactgaccccttATG

    DR0027 Gene: DR0027     GI: 15805068     BI number: DR0027     GOG: COG0445     Description: gidA protei             t           t  c           a  a GA       a  g A  G      C  g AT       A  a TG        Cg CG        Cg |  C       Tg |  C      G  g       cc |  A       Gc       t  t CG        At       c  a CG        Cg        gc G  T       Cg        cg A  C      G  |       gc GC        Gc       |  a TA        Tg        gc GC        Gc        ta Ta        At        cg Ta        Gc        gc                         acgtttattaggcgctcaggccgctacactgaccccttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG0445 NAD/FAD-utilizing enzyme apparently involved in cell division ... can be seen here     ..................................................................................................................