                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-24.00 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-20.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCAGGACGCTGCGCCGCCCTCGCTGTTCGGTGACGCGGTGCCGCAGCGGGGCAGGGG
AGAAGTGCCCTACGCCGCATACCTGCGCGAGGCTGCGGAGCGGGCGCAAATGCTGAAC
GTAGCAGCGCGGCGCCCCATTCCGGAACAAGTGCCGGGCGACTTGGTCTTTTTTGCTT
ACTGAggggctttttgcccgtccagcccagccgaactccccccaattcgccttttggagccgtggaatctacaatgcctaacgctcgttagctagac
agatttcacaggccgccggggcaagccttTTG

    DR0029 --- DR0030 --- DR0031 --- DR0032 Gene: DR0029     GI: 15805070     BI number: DR0029     GOG: COG1071     Description: 2-oxo acid dehydrogenase, E1 component, alpha subunit Gene: DR0030     GI: 15805071     BI number: DR0030     GOG: COG0022     Description: 2-oxo acid dehydrogenase, E1 component, beta subunit Gene: DR0031     GI: 15805072     BI number: DR0031     GOG: -------     Description: hypothetical protein Gene: DR0032     GI: 15805073     BI number: DR0032     GOG: COG0508     Description: 2-oxo acid dehydrogenase, E2 componen             G           C  T   G       A  A C  C      A  G G  G       GC TA        TA CG        CG CG        GC        GA A  C       TG       G  A T  |      A  C      C  C AT       A  G      C  A CG       A  |       TA GC        CG        TG CG        GC        AT CG        CG        CG G  A       GC       |  C C  G       GC       |  C A  C       GC        CG T  |      |  C       CG CG       C  A       CG CG        GT        GC CG        AT        CG GC        GC       |  A TG        GC        GC GC        CG        GT                         TGGTCTTTTTTGCTTACTGAggggctttttgcccgtccagcccagccgaactccccccaattcgccttttggagccgtggaatctacaatgcctaacgctcgttagctagacagatttcacaggccgccggggcaagccttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1071 Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, alpha subunit ... can be seen here [C] COG0022 Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, beta subunit ... can be seen here [C] COG0508 Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide acyltransferase (E2) component, and related enzymes ... can be seen here     ..................................................................................................................