                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-17.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTTTCAGAAGGCCACCAATTACCGCCTGCCGTTGGCACTCGTTCTTGCAGACACTGA
CGCTTACGGCCCCCGCTTCAGCGAACTGGCGCTCGAACATCGCCAGCACCCGCTGATT
TGCTTTTTCGATTCGGAAGAGGCGGCGCGGGCGTGGCTGGAACGGGTCTAGccgcctgaccc
caggcccgcagccgataagctaaactgaattacggtgctgtgcgccgtgcttttttttgacccctgtgcaggtggcaaggagacaaagaaagtaagtctg
ggcgcatggctggagggctgagATG

    DR0035 Gene: DR0035     GI: 15805076     BI number: DR0035     GOG: COG0104     Description: adenylosuccinate synthas             t ct       a  t c  g      a  a g  a       gc c  c       tg c  c       cg G  c       at A  c      a  | Ta       a  | Cg       t  | Tg       c  |        g Gc       g  |      t  t Gc       a  |       cg Gc       a  |       gc Cg       t  |       tg A  |      a  |       gc A  |      g  |       gc G  |      c  |       cg Gc        cg        at Ta        gc        tg Cg        at       t  c Gc        cg        at Gc        gt        at Tg        cg        gt                         tttttgacccctgtgcaggtggcaaggagacaaagaaagtaagtctgggcgcatggctggagggctgagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0104 Adenylosuccinate synthase ... can be seen here     ..................................................................................................................