                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-27.20 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGACGCGGCTGCTCGACGCCAACCACATCACCATTTCCAAGTCCACCCTGCCCTACG
ACACCGAGAAAATCCTGCACGGCGGCGGCATCCGCATCGGCACGCCCGCCGTCACCAC
GCGCGGCATGACCGAAGCGCACATGACGCAGGTGGCCGACCTGATTGACCGTGCCCTG
AAAGGCGAGGACGTGCAGGCCAAGGTCCACGACTTTGCCGGTGGCTTCCCACTGCCCT
GAagacggctgcaccggccttccgctgctcacttcctgggcagcgggaggttttttgacggttcgtcgGTG

    DR0039 Gene: DR0039     GI: 15805080     BI number: DR0039     GOG: COG2203,COG2206     Description: conserved hypothetical protei   C C  T C  G       ct G  A      c  t        t Ta        gc       t  c Cg        gc       c  c A  a       cg        at C  c      c  c       cg Cg        at        tg Cg        cg        cg T  c       gc        gc T  t      t  t       ta Cg       c  c       cg Gc       g  a       gc G  |      g  |       cg Ta       c  |       cg Gc       a  |       tg Gc        gc        ta Cg        at        cg Cg        At        cg Gc        Gc        gt                         tttttgacggttcgtcgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2203 FOG: GAF domain ... can be seen here [T] COG2206 HD-GYP domain ... can be seen here     ..................................................................................................................