                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-19.10 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -9.24 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCATCATCAACGCGCCGCAGAGCGCCATCCTGGGAATGCACAACATCATCGAGCGCC
CGATTGCCCAGAACGGTCAGGTCGTGATCGCCCCGATGATGTACCTCGCCGTGTCCTA
CGACCACCGCCTGATCGACGGCAAGGAAGCGGTGCAGTTCCTGGTGATGATCAAGAAC
CTGCTGGAAGACCCGGCGCGCATGTTGCTGGACCTCTGAgctgtcctgttctctctgccccggccccgcaa
ggctggggcttttttggtcagagggccgtgagggagagcggcctaagctgacctcATG

    DR0082 --- DR0081 Gene: DR0082     GI: 15805123     BI number: DR0082     GOG: -------     Description: hypothetical protein Gene: DR0081     GI: 15805122     BI number: DR0081     GOG: COG2120     Description: conserved hypothetical protei   A        tc C  T      g  c G  G      t  t C  T       cg GT        gt CG        At GC        Gc GT       |  t CG       |  c CG       T  t C  A      C  c A  C      T  t GC       C  g AT       C  c A  |      A  c GC        Gc        gc GT        Gc       c  a |  G       Tg       c  a TA        Cg        cg Cg        Gc        cg Gc       T  c       gc T  t      T  c       gt C  g      G  c       cg C  |      T  |       cg A  |      A  |       cg At        Cg        cg Gc        Gc        gc                         ttttttggtcagagggccgtgagggagagcggcctaagctgacctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2120 Uncharacterized proteins, LmbE homologs ... can be seen here     ..................................................................................................................