                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-28.20 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-13.90 kcal/mol
Anti-antiterminator:   Size=65 nt.     Delta G=-17.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTGAAGGCCGGGAACATCCTGGTTCGTCAGCGCGGCACCAAGTTCAAGGCGGGTCAG
GGCGTCGGCATGGGCCGCGACCACACCCTGTTCGCGCTCTCCGACGGCAAGGTCGTCT
TCATCAACAAGGGCAAGGGCGCCCGCTTCATCAGCATCGAAGCTGCCCAGACCGAAGT
CGCTGCCGACTGAatttcggcggacagccgcgccctgcccagttctgggggggcgcggttttttttcacctgcttcggcggcctgacgcct
cctgtcagtccccggcaggtctctggaggtccgaaATG

    DR0084 Gene: DR0084     GI: 15805125     BI number: DR0084     GOG: COG0536     Description: GTP-binding protein Ob   G A  C C  A T  T A  C CG TA TA CG GC C  | C  | C  | GT CG GC GC GC A  A A  G C  A G  |        t        tt GC       a  t      g  c GC       A  t       at A  |       Gc        cg A  |       Tg        cg C  |       Cg        cg A  |      A  |      g  | A  |       Gc        tg C  |       Cg        cg T  |       Cg        cg A  |      |  a       cg CG        Gc        gc TA        Ta        cg TA        Cg        gc CG        Gc        cg T  T      C  c       cg GC        Tg        gt CG        Gc        at                         ttttttcacctgcttcggcggcctgacgcctcctgtcagtccccggcaggtctctggaggtccgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0536 Predicted GTPase ... can be seen here     ..................................................................................................................