                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-13.50 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-20.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTGACCTTTACGGCGCGGCACGTAGTCCGCCACCACGCCGACGTGCACCTGCCGGCC
ATCGGGGAGGCCGAACCAGCAGCCGCCGTTCTTACGGAGAGCCTCCGGTTTTTGCAGT
TCGGGGAGGCCCAACACCCCGGCGAAAAACTCGCGGGCGGCGACCTCGCAGCCTGCCG
GGGCTTCCAGTTGCACGTGGTCCAGTCCGTTGAGAAGGGGCATggccgcaggataggagctggcaggc
ggcttctttgctacttctctagagacaacaacccgcctgaagcgtctttcctgaccctTTG

    DR0108 Gene: DR0108     GI: 15805148     BI number: DR0108     GOG: COG2409     Description: conserved hypothetical protei GG C  G CG GC |  T |  T |  C T  C C  A CG GT AT CG         A GC       G  G |  A       TA |  C       TA C  G      G  G        a T  T       CG       g  g CG        CG        gc CG        TG        at AT        GC        tg GC       |  A      a  g C  C       AT       g  c G  A       Cg       g  a G  |       Cg       a  g CG       T  |       cg GT        Gc        gc GC        Gc        cg GC        Tg        cg CG        Gc        gc                         ttctttgctacttctctagagacaacaacccgcctgaagcgtctttcctgaccctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2409 Predicted drug exporters of the RND superfamily ... can be seen here     ..................................................................................................................