Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:46 nt.    Distance to gene:0 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-32.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaag-tagcct. It has a score value of 63.59 and is shown in blue

ttgaagtgcccggtgagtgcggtagcctgctgggcagctcccctctgttgatttcacactctcaggaaaccgcgaacagtcggccccatcaagcttgatg
gggccgactgttggtttTTG

    DR0145 --- DR0146


Gene: DR0145     GI: 15805182     BI number: DR0145     GOG: NOG47721     Description: hypothetical protein
Gene: DR0146     GI: 15805183     BI number: DR0146     GOG: COG0084     Description: conserved hypothetical protei


          gc
         a  t
          at
          cg
          ta
          at
          cg
          cg
          cg
          cg
          gc
          gc
          cg
          ta
          gc
          at
          cg
          at
          at
            ggtttTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0084 Mg-dependent DNase ... can be seen here

    ..................................................................................................................