                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:183 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -9.46 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-15.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGAGAAGCGCCGGGTGGCCGACTTCGGGGCGCAGAAGGAGCGGTTGGAAGGAGTGT
TGGCTCAGTTGGGGTGAgatgttgagggaggcccgctgcctgcgagggtggcgggtttttcataatttccagagctacgttgtatttt
agatgcccttactcagatataacgcctgaattccacccaaatgtctgtgctcagagaggagtgatgaaatattaatcaagcagaaccgtctgatcaagaa
aaggcactgcaagtatttgatcaagcagtggcctatcaatacgctgccgaggttATG

    DR0147 Gene: DR0147     GI: 15805184     BI number: DR0147     GOG: -------     Description: hypothetical protei   A         t A  G      t  g G  G      g  a A  A      t  g CG       a  g GC       g  g CG       A  a G  G      G  g GT        Tg GT        Gc G  G       Gc CG        Gc TA       G  | TA       T  | |  G       Tg        cg |  G       Gc       g  a |  A       At        tg |  G      C  |       cg |  T      T  |       cg CG        Cg       g  t AT        Gc       t  g GT        Gc        cg CG       T  t       gc CG        Tg        cg GC        Gc        cg GT        Tg        cg                         tttttcataatttccagagctacgttgtattttagatgcccttactcagatataacgcctgaattccacccaaatgtctgtgctcagagaggagtgatgaaatattaatcaagcagaaccgtctgatcaagaaaaggcactgcaagtatttgatcaagcagtggcctatcaatacgctgccgaggttATG     ..................................................................................................................