                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-15.89 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCTCGCTGGCCTGACCGGGCACGTCTGGGAAGCGGGCATCGGGCATGTCTCGGAAGT
GTTCAGTGGCGACGCGCTCACGCCGGGCGGCTGCCCCTTTCAGGCGTGGAGCGTGGCC
GAGCTGCTGCGGGCTCACGTGCTGGTCAGCCTCAGCGAAGCGCAGGCCCACGAGCAGG
CGCGGCAGACCCACACCCGCTGAcacaaattcactgagagcggcgcgtccggtcgcctttttctgttcttagtcgggacactt
actcccttgacgtagggcggacaccaaccctagcatcgccgggATG

    DR0192 --- DR0193 Gene: DR0192     GI: 15805228     BI number: DR0192     GOG: COG1051     Description: MutT/nudix family protein Gene: DR0193     GI: 15805229     BI number: DR0193     GOG: COG2383     Description: hypothetical protei AC         t C  G      a  t C  A      a  c CG       a  a GC       c  c G  A       at A  G       cg CG       A  a GC       G  g CG        Ta GC        Cg |  G       Gc |  G       Cg |  C       Cg |  A      C  | |  G      A  | |  A      C  | |  C      A  | |  C      C  | |  C      C  |        t |  A      C  |      g  c |  C      A  |      c  c |  A      G  |      g  g A  C      A  |       cg A  C      C  |       gt GC       G  |       gc CG        Gc        cg GC        Cg        gc AT        Gc       a  | CG        Cg        gc TA        Gt        at                         ttttctgttcttagtcgggacacttactcccttgacgtagggcggacaccaaccctagcatcgccgggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG1051 ADP-ribose pyrophosphatase ... can be seen here [S] COG2383 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................