                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-15.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGGCACCTTCAATACCTACCGCGTCGAAGCGCAAACCATCAGCACGACGACCTTTC
AGGACCCCAAGATGGCCGCCGCGATGGGCCAGAGGAACAAGCCCACCGTGACTACGAC
GACCACCTGGTACGCCAAAGACATTCCGGGCCTGATCGTCAAGATGGAATCCAAGGGC
ATGTCGAGTCTGCTGCTGAAATACCAGAAATAGttgttcccgccgccggaacgaaaagccggccccggaggttcag
caggtgttaatctagggaggcagcccgcagacggctgaccttcttcttttTTG

    DR0226 --- DR0225 --- DR0224 --- DR0223 --- DR0222 Gene: DR0226     GI: 15805262     BI number: DR0226     GOG: COG0152     Description: phosphoribosylaminoimidazole-succinocarboxamide synthase Gene: DR0225     GI: 15805261     BI number: DR0225     GOG: -------     Description: hypothetical protein Gene: DR0224     GI: 15805260     BI number: DR0224     GOG: COG1828     Description: conserved hypothetical protein Gene: DR0223     GI: 15805259     BI number: DR0223     GOG: COG0047     Description: phosphoribosylformylglycinamidine synthase I Gene: DR0222     GI: 15805258     BI number: DR0222     GOG: COG0046     Description: phosphoribosylformylglycinamidine synthase I            gg           a  t            cg   a        gt g  a       at c  a      c  | a  a       ta a  g       ta gc        gt gc        gc cg        at         a cg       g  a      c  g gc       g  |      g  a c  c       cg       c  c c  c       cg        cg gc        cg        cg cg       |  a       gc cg       |  g       at |  a      |  g       cg cg       |  c      |  a tg       |  a       gc |  t       cg        gc t  t       gc        at gc        gc        gt ta       c  c       gc tg        cg        gt Gc        gc        at                         cttttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0152 Phosphoribosylaminoimidazolesuccinocarboxamide (SAICAR) synthase ... can be seen here [F] COG1828 Phosphoribosylformylglycinamidine (FGAM) synthase, PurS component ... can be seen here [F] COG0047 Phosphoribosylformylglycinamidine (FGAM) synthase, glutamine amidotransferase domain ... can be seen here [F] COG0046 Phosphoribosylformylglycinamidine (FGAM) synthase, synthetase domain ... can be seen here     ..................................................................................................................