                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:192 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-23.60 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-14.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGCTCCCCGACGACGCCTTCACCCTCCACCGTGAACTGCTGGCCGTCGCCGCTGGT
GATGGTCCAGTGGCGGCTGAGCAGTTTCCAGCTGTCGTCGGTGTTGTTTTCGATGGTG
ATGAAATACGCGAACAATTGGCGTTGCGGGGTGCTCTGCGCGGGCAGGTGGTGGACCT
GTACGGACACGGTGATGTCGGGAGAAGAGGTCATaggttgatgctacgggtctagagcatttgacaaaaaggtgg
cacagctttttggcgagcgaagcgagtacaaaacgttgagcaggacggagaATG

    DR0229 --- DR0230 --- DR0231 Gene: DR0229     GI: 15805265     BI number: DR0229     GOG: COG1363     Description: endoglucanase, putative Gene: DR0230     GI: 15805266     BI number: DR0230     GOG: COG0245     Description: conserved hypothetical protein Gene: DR0231     GI: 15805267     BI number: DR0231     GOG: COG0219     Description: RNA methyltransferase, putativ CC T  A C  C C  C CG AT CG TA TA         T |  C      A  G |  T      G  G |  G      T  T |  C       GC |  T       GC CG        TA         G CG        CG       A  T |  C       GT       C  T GC        CG       G  T CG        CG       A  C AT        GC        GC GC       C  |       TA CG       T  |       CG A  C      G  |       GC GC        CG        GT CG        CG        CG |  C       GC        GT |  T       GT        GC CG       |  G       TG CG        TA       G  T |  T       CG       A  C CG        GC        CG TA        TA        CG                         TGTTGTTTTCGATGGTGATGAAATACGCGAACAATTGGCGTTGCGGGGTGCTCTGCGCGGGCAGGTGGTGGACCTGTACGGACACGGTGATGTCGGGAGAAGAGGTCATaggttgatgctacgggtctagagcatttgacaaaaaggtggcacagctttttggcgagcgaagcgagtacaaaacgttgagcaggacggagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1363 Cellulase M and related proteins ... can be seen here [I] COG0245 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase ... can be seen here [J] COG0219 Predicted rRNA methylase (SpoU class) ... can be seen here     ..................................................................................................................